Review



crispr glycerol stock arrayed whole mouse genome sgrna library  (Merck & Co)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Merck & Co crispr glycerol stock arrayed whole mouse genome sgrna library
    Crispr Glycerol Stock Arrayed Whole Mouse Genome Sgrna Library, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+glycerol+stock+arrayed+whole+mouse+genome+sgrna+library/crispr+glycerol+arrayed+mouse+genome+sgrna/bio_rxiv__2022__12__19__520971-111-28-22
    Average 90 stars, based on 1 article reviews
    crispr glycerol stock arrayed whole mouse genome sgrna library - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis
    Article Snippet: Two independent constitutively expressed sgRNAs targeting Tfap4 (sgRNA-1 5’-CGCATGCAGAGTATCAACGCGG; sgRNA-2 5’GATTGCCAACAGCAACGAGCGG) in a vector also containing a constitutively expressed BFP tag were obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, available at WEHI ( www.sigmaaldrich.com MSANGERG).A positive control sgRNA targeting Trp53 (5’-GGCAACTATGGCTTCCACCT); and a negative control sgRNA targeting human BIM (5’-GCCCAAGAGTTGCGGCGTAT), both in a vector also containing a BFP tag, were derived from the constitutive sgRNA FUGW expression vector previously described ( Janic et al , 2018 ) and used for original hematopoietic reconstitution experiments. .. A vector constitutively expressing a negative control sgRNA targeting human NLRC5 (sgRNA-1 5’-GCTGCAGAAGTGTCAGCTCCAGG) and the BFP tag was also obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, and this vector was used for the pre-leukemic analyzes. .. HEK293T cells were maintained in DMEM (Gibco) medium containing 10% (v/v) heat inactivated fetal calf serum (HI-FCS; Gibco), 100 U/mL Penicillin (Sigma) and 100 μg/mL streptomycin (Sigma).

    Expressing:

    Article Title: Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis
    Article Snippet: Two independent constitutively expressed sgRNAs targeting Tfap4 (sgRNA-1 5’-CGCATGCAGAGTATCAACGCGG; sgRNA-2 5’GATTGCCAACAGCAACGAGCGG) in a vector also containing a constitutively expressed BFP tag were obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, available at WEHI ( www.sigmaaldrich.com MSANGERG).A positive control sgRNA targeting Trp53 (5’-GGCAACTATGGCTTCCACCT); and a negative control sgRNA targeting human BIM (5’-GCCCAAGAGTTGCGGCGTAT), both in a vector also containing a BFP tag, were derived from the constitutive sgRNA FUGW expression vector previously described ( Janic et al , 2018 ) and used for original hematopoietic reconstitution experiments. .. A vector constitutively expressing a negative control sgRNA targeting human NLRC5 (sgRNA-1 5’-GCTGCAGAAGTGTCAGCTCCAGG) and the BFP tag was also obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, and this vector was used for the pre-leukemic analyzes. .. HEK293T cells were maintained in DMEM (Gibco) medium containing 10% (v/v) heat inactivated fetal calf serum (HI-FCS; Gibco), 100 U/mL Penicillin (Sigma) and 100 μg/mL streptomycin (Sigma).

    Negative Control:

    Article Title: Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis
    Article Snippet: Two independent constitutively expressed sgRNAs targeting Tfap4 (sgRNA-1 5’-CGCATGCAGAGTATCAACGCGG; sgRNA-2 5’GATTGCCAACAGCAACGAGCGG) in a vector also containing a constitutively expressed BFP tag were obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, available at WEHI ( www.sigmaaldrich.com MSANGERG).A positive control sgRNA targeting Trp53 (5’-GGCAACTATGGCTTCCACCT); and a negative control sgRNA targeting human BIM (5’-GCCCAAGAGTTGCGGCGTAT), both in a vector also containing a BFP tag, were derived from the constitutive sgRNA FUGW expression vector previously described ( Janic et al , 2018 ) and used for original hematopoietic reconstitution experiments. .. A vector constitutively expressing a negative control sgRNA targeting human NLRC5 (sgRNA-1 5’-GCTGCAGAAGTGTCAGCTCCAGG) and the BFP tag was also obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, and this vector was used for the pre-leukemic analyzes. .. HEK293T cells were maintained in DMEM (Gibco) medium containing 10% (v/v) heat inactivated fetal calf serum (HI-FCS; Gibco), 100 U/mL Penicillin (Sigma) and 100 μg/mL streptomycin (Sigma).

    CRISPR:

    Article Title: Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis
    Article Snippet: Two independent constitutively expressed sgRNAs targeting Tfap4 (sgRNA-1 5’-CGCATGCAGAGTATCAACGCGG; sgRNA-2 5’GATTGCCAACAGCAACGAGCGG) in a vector also containing a constitutively expressed BFP tag were obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, available at WEHI ( www.sigmaaldrich.com MSANGERG).A positive control sgRNA targeting Trp53 (5’-GGCAACTATGGCTTCCACCT); and a negative control sgRNA targeting human BIM (5’-GCCCAAGAGTTGCGGCGTAT), both in a vector also containing a BFP tag, were derived from the constitutive sgRNA FUGW expression vector previously described ( Janic et al , 2018 ) and used for original hematopoietic reconstitution experiments. .. A vector constitutively expressing a negative control sgRNA targeting human NLRC5 (sgRNA-1 5’-GCTGCAGAAGTGTCAGCTCCAGG) and the BFP tag was also obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, and this vector was used for the pre-leukemic analyzes. .. HEK293T cells were maintained in DMEM (Gibco) medium containing 10% (v/v) heat inactivated fetal calf serum (HI-FCS; Gibco), 100 U/mL Penicillin (Sigma) and 100 μg/mL streptomycin (Sigma).



    Similar Products

    90
    Merck & Co crispr glycerol stock arrayed whole mouse genome sgrna library
    Crispr Glycerol Stock Arrayed Whole Mouse Genome Sgrna Library, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+glycerol+stock+arrayed+whole+mouse+genome+sgrna+library/crispr+glycerol+arrayed+mouse+genome+sgrna/bio_rxiv__2022__12__19__520971-111-28-22
    Average 90 stars, based on 1 article reviews
    crispr glycerol stock arrayed whole mouse genome sgrna library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results