crispr glycerol stock arrayed whole mouse genome sgrna library (Merck & Co)
90
Structured Review
Merck & Co
crispr glycerol stock arrayed whole mouse genome sgrna library
Crispr Glycerol Stock Arrayed Whole Mouse Genome Sgrna Library, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+glycerol+stock+arrayed+whole+mouse+genome+sgrna+library/crispr+glycerol+arrayed+mouse+genome+sgrna/bio_rxiv__2022__12__19__520971-111-28-22
Average 90 stars, based on 1 article reviews
Crispr Glycerol Stock Arrayed Whole Mouse Genome Sgrna Library, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+glycerol+stock+arrayed+whole+mouse+genome+sgrna+library/crispr+glycerol+arrayed+mouse+genome+sgrna/bio_rxiv__2022__12__19__520971-111-28-22
Average 90 stars, based on 1 article reviews
crispr glycerol stock arrayed whole mouse genome sgrna library - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis Article Snippet: Two independent constitutively expressed sgRNAs targeting Tfap4 (sgRNA-1 5’-CGCATGCAGAGTATCAACGCGG; sgRNA-2 5’GATTGCCAACAGCAACGAGCGG) in a vector also containing a constitutively expressed BFP tag were obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, available at WEHI ( www.sigmaaldrich.com MSANGERG).A positive control sgRNA targeting Trp53 (5’-GGCAACTATGGCTTCCACCT); and a negative control sgRNA targeting human BIM (5’-GCCCAAGAGTTGCGGCGTAT), both in a vector also containing a BFP tag, were derived from the constitutive sgRNA FUGW expression vector previously described ( Janic et al , 2018 ) and used for original hematopoietic reconstitution experiments. .. A vector constitutively expressing a negative control sgRNA targeting human NLRC5 (sgRNA-1 5’-GCTGCAGAAGTGTCAGCTCCAGG) and the BFP tag was also obtained from the Merck CRISPR glycerol stock arrayed whole Expressing:Article Title: Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis Article Snippet: Two independent constitutively expressed sgRNAs targeting Tfap4 (sgRNA-1 5’-CGCATGCAGAGTATCAACGCGG; sgRNA-2 5’GATTGCCAACAGCAACGAGCGG) in a vector also containing a constitutively expressed BFP tag were obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, available at WEHI ( www.sigmaaldrich.com MSANGERG).A positive control sgRNA targeting Trp53 (5’-GGCAACTATGGCTTCCACCT); and a negative control sgRNA targeting human BIM (5’-GCCCAAGAGTTGCGGCGTAT), both in a vector also containing a BFP tag, were derived from the constitutive sgRNA FUGW expression vector previously described ( Janic et al , 2018 ) and used for original hematopoietic reconstitution experiments. .. A vector constitutively expressing a negative control sgRNA targeting human NLRC5 (sgRNA-1 5’-GCTGCAGAAGTGTCAGCTCCAGG) and the BFP tag was also obtained from the Merck CRISPR glycerol stock arrayed whole Negative Control:Article Title: Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis Article Snippet: Two independent constitutively expressed sgRNAs targeting Tfap4 (sgRNA-1 5’-CGCATGCAGAGTATCAACGCGG; sgRNA-2 5’GATTGCCAACAGCAACGAGCGG) in a vector also containing a constitutively expressed BFP tag were obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, available at WEHI ( www.sigmaaldrich.com MSANGERG).A positive control sgRNA targeting Trp53 (5’-GGCAACTATGGCTTCCACCT); and a negative control sgRNA targeting human BIM (5’-GCCCAAGAGTTGCGGCGTAT), both in a vector also containing a BFP tag, were derived from the constitutive sgRNA FUGW expression vector previously described ( Janic et al , 2018 ) and used for original hematopoietic reconstitution experiments. .. A vector constitutively expressing a negative control sgRNA targeting human NLRC5 (sgRNA-1 5’-GCTGCAGAAGTGTCAGCTCCAGG) and the BFP tag was also obtained from the Merck CRISPR glycerol stock arrayed whole CRISPR:Article Title: Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis Article Snippet: Two independent constitutively expressed sgRNAs targeting Tfap4 (sgRNA-1 5’-CGCATGCAGAGTATCAACGCGG; sgRNA-2 5’GATTGCCAACAGCAACGAGCGG) in a vector also containing a constitutively expressed BFP tag were obtained from the Merck CRISPR glycerol stock arrayed whole mouse genome sgRNA library, available at WEHI ( www.sigmaaldrich.com MSANGERG).A positive control sgRNA targeting Trp53 (5’-GGCAACTATGGCTTCCACCT); and a negative control sgRNA targeting human BIM (5’-GCCCAAGAGTTGCGGCGTAT), both in a vector also containing a BFP tag, were derived from the constitutive sgRNA FUGW expression vector previously described ( Janic et al , 2018 ) and used for original hematopoietic reconstitution experiments. .. A vector constitutively expressing a negative control sgRNA targeting human NLRC5 (sgRNA-1 5’-GCTGCAGAAGTGTCAGCTCCAGG) and the BFP tag was also obtained from the Merck CRISPR glycerol stock arrayed whole |